Mushroom Quiz

Name

First Last

Which of the following is false regarding the aborted entoloma?

Caused by Entoloma abortivum parasitizing Armillaria species
Turns bright blue when cut
Irregular white blobs with a marbled pinkish brown interior
It is edible

Using a magnifying glass, you investigate some tiny, red, cup-shaped fungi on a dead log, and find that each one is lined with dark “hairs”. They belong to the genus Scutellinia and are known as

Scarlet Cups
Eyelash Cups
Hairy Fairy Cups
Jelly Cups

In the moss on the ground you notice a slim, soft black mushroom with a stem and an elongated oval head with a groove down the middle—a member of the genus Geoglossum, what most of us call:

Ribbed Cup
Hare’s Ear
Earth Tongue
Black Foot Morel

Congratulations! You’ve found the finely sculpted, yet completely hollow Morchella americana, also known as:

Yellow Morel
Half Free Morel
Veined Cup
Black Morel

Urnula craterium would be a perfect Halloween fungus, but alas! This dark and creepy cauldron only grows in early spring. Its common name is:

Earth Tongue
Hairy Fairy Cup
Dead Man’s Fingers
Devil’s Urn

What is a slime mold?

A multicellular organism
Single celled organism that fuse together to form a fruiting body.
A type of fungi
A lichen

Bisporella citrina catches your eye as you pass a debarked log, even though each one is only a few millimeters across, because there are hundreds of these tiny, bright:

Mayapple Rust
Witch’s Butter
Yellow Fairy Cups
Star Mollisia

If a fungus is mycorrhizal what does that mean?

A fungus which grows in association with the roots of a plant in a symbiotic relationship
A fungus that rots wood
A fungus that releases spores to the air
A fungus that lives underground

The common split gill or Schizophyllum commune has how many mating types?

2
Approximately 100
Over 20000
4

How many spores does a giant puffball (Calvatia gigantea) contain?

Over a trillion
Ten thousand
1 million
1 billion

Advanced question. In most guide books only one or two eyelash cup species are listed. So far we have identified 6 diffenret species using their microscopic features. Using the images of the spores and other identifying features and measurement values can you identify this species? Average 18 µm by 11 µm Q=1.65 with large warts that mostly have interconnections. Black/Brown margin hairs are ~1650 µm long, rooting with 2 to 3 forks and a pointed top. Hair width ~42µm close to base, hair wall thickness ~7µm.

Use this key to identify the exact species of we have found.

Scutellinia scutellate
Scutellinia crinita
Scutellinia pennsylvanica
Scutellinia setosa

Which of these are common features of Amanitias?

Gills brittle, white spore print, brightly colored cap, stem breaks like chalk.
Gills white and even, white to lilac spore print, stem lacking or off center.
Gills, white spore print, scaly cap, grows on wood.
Gills, white spore print, universal veil, bulbus base.

Intermediate question. Which Scarlet cup species is this? Spores are ~27µm by ~11µm with multiple small oil drops. The cup has twisted and curved hairs on its undersurface.

Sarcoscypha austriaca
Sarcoscypha occidentalis
Sarcoscypha dudleyi
Sarcoscypha coccinea

Are those creepy fingers sticking out of the ground? Grayish blue-green with lighter “nails” in May and June; later in the year they will turn black and a bit bumpy. They are Xylaria polymorpha, commonly known as:

Devil’s Urn
Black Crust
Dead Man’s Fingers
Brittle Cinder

You come across Galiella rufa--thick, peanut-butter-brown, cup-shaped mushrooms attached to a stick on the ground. Each is surrounded by a dry, finely hairy, black outer surface, which squishes like a soft gum drop. They are commonly called:

Peanut Butter Cups
Goodyear Fungus
Black Jelly
Hairy Rubber Cups

Grifola frondosa is a polypore mushroom typically found at the base of oak trees in the fall and is a choice edible. It's common name is:

Sarcoscypha austriaca, one of the first colorful cup fungi to peek out from under the dead leaves in spring, is commonly known as:

Scarlet Cup
False Morel
Eyelash Cup
Elfin Saddle

On a damp log, you find a decorative grouping of soft gray, merging circles and ovals, each surrounded by clean white as they spread along the surface of the log. Its official name (quite a tongue twister) is Kretzschmaria deusta. The soft colors will soon become black and flaky, which has earned it the name:

Brittle Cinder
Spreading Crust
Black Crust
Black Flakes

Intermediate question. How would you describe these gills?

Free
Adnate
Sinuate
Decurrent

Intermediate question. Which mushroom toxin causes an adverse reaction to alcohol similar to Disulfiram (Anatbuse) used to treat chronic alcoholism?

α-Amanitin
Coprine
Muscarine
Gyromitrin

Most people who love wild mushroom hunting would be excellent partners to be quarantined with for two months.

Only if they were good cooks
No Way
Of course they would
I'm not too sure of that

Which one of these is this a Chanterelle mushroom?

Advanced question. This is a DNA sequence or barcode for an ITS region of a fungi. What species is it from?

>WPMC20131005-2-4
ACTTTTTGTAGGCTTGGTGGGATAGGCTGACTTCGGTCGGCTTTGAATGCCTCGCCTATGTATTAAAACAAACGCTTCAG TTTAGAATGTAACCTTGCATAATAAGCAAATAAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAA CGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGG TATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGTATCATCAACCTTCAACACTTTTGTGTCTGTAGGCTTGGACTTGGA GGTCGTGTCGGCGTTCGCGTCGGCTCCTCTGAAATGCATTAGCGTGAATCTTACGAATCGCCCTCGGTGTGATAATTTCT ACGCCGTAGACGTGCAGTATATAGTGTTCGTGCTTACAACCGTCTGCRAAGACAACATCATTGACAATCTGACCTCAAAT CAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCG AGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTCGATCGTCCGAGTTGTAGTCTGGAGAAGCGTCTTCCGCG CTGGACCGTGTACAAGTCTCTTGGAAYAGAGCGTCGTAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTT GTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTG GCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAAT TGCTGAAAGGGAAACGATTGAAGTCAGTCGCGTCGTCTAGAACTCAACCTTGCCTCGGCTCGGTGCATTTTCTAGTTGAC GGGCCAGCATCAGTTTTGACCGTTGGAAAAAGGTCCTTGGAATGTGGCACCTTCGGGTGTGTTATAGCCTCGGGTCGTAT ACGACGGTTGGGACTGAGGACCGCAGCACGCCTTTATGGCCGGGG
You will need to use the online BLAST server to identify it. Tip: Search the entire nucleotide database rather than the ITS type sequence subset to obtain a good result.

What is this very common mushroom?

False turkey tail (Stereum ostrea)
Turkey tail (Trametes versicolor)
Crowded Parchment (Stereum complicatum)
Violet Toothed polypore (Trichaptum biforme)

These mushrooms are not social distancing. How would you describe them?

Single
Scattered
Caespitose
Nongregarious

What do Chanterelles grow on?

Rotting logs
The ground
Wood mulch
Live trees

You’ve discovered what looks like a morel, with a long, granular stem and a cap which turns under before it attaches to the stem. When sliced lengthwise, the mushroom is hollow from top to bottom with a definite attachment to the stem— it’s Morchella punctipes, commonly called

Fuzzy Foot
Half Free Morel
Tulip Morel
Mulch Morel

What color are the spores of oyster mushrooms?

Green
Purple
Rusty brown
White to yellow to lyliac

Intermediate question. Which of these two mushrooms can turn black when bruised or cut?

Marasmius nigrodiscus and Russula compacta
Lactifluus helvus and Lactarius lignyotus
Tylopilus alboater and Strobilomyces strobilaceus
Xanthoconium purpureum and Gyroporus castaneus

Email

This field is for validation purposes and should be left unchanged.

Western Pennsylvania Mushroom Club

Mushroom quiz

Recent Posts

Recent Comments

Mushroom Catalog