Mushroom Quiz

Here is a little test of your mushroom knowledge that club identifiers Fluff Berger, John Stuart and Richard Jacob have prepared. The questions range from easy to quite hard and you may have to do a bit of research. We hope it gives you a little something to think about while in lock down. Let us know if you like it. Also if you have questions to add to the quiz please email. The questions cover the sort of capabilities that the quiz software can support.

Name
First Last
You’ve discovered what looks like a morel, with a long, granular stem and a cap which turns under before it attaches to the stem. When sliced lengthwise, the mushroom is hollow from top to bottom with a definite attachment to the stem— it’s Morchella punctipes, commonly called
- Mulch Morel
- Tulip Morel
- Half Free Morel
- Fuzzy Foot
Intermediate question. How would you describe these gills?
- Adnate
- Free
- Decurrent
- Sinuate
If a fungus is mycorrhizal what does that mean?
- A fungus which grows in association with the roots of a plant in a symbiotic relationship
- A fungus that rots wood
- A fungus that releases spores to the air
- A fungus that lives underground
Congratulations! You’ve found the finely sculpted, yet completely hollow Morchella americana, also known as:
- Black Morel
- Veined Cup
- Yellow Morel
- Half Free Morel
Bisporella citrina catches your eye as you pass a debarked log, even though each one is only a few millimeters across, because there are hundreds of these tiny, bright:
- Star Mollisia
- Witch’s Butter
- Mayapple Rust
- Yellow Fairy Cups
Intermediate question. Which of these two mushrooms can turn black when bruised or cut?
- Xanthoconium purpureum and Gyroporus castaneus
- Tylopilus alboater and Strobilomyces strobilaceus
- Marasmius nigrodiscus and Russula compacta
- Lactifluus helvus and Lactarius lignyotus
Intermediate question. Which Scarlet cup species is this? Spores are ~27µm by ~11µm with multiple small oil drops. The cup has twisted and curved hairs on its undersurface.
- Sarcoscypha dudleyi
- Sarcoscypha occidentalis
- Sarcoscypha austriaca
- Sarcoscypha coccinea
Most people who love wild mushroom hunting would be excellent partners to be quarantined with for two months.
- Only if they were good cooks
- Of course they would
- No Way
- I'm not too sure of that
Which of these are common features of Amanitias?
- Gills brittle, white spore print, brightly colored cap, stem breaks like chalk.
- Gills white and even, white to lilac spore print, stem lacking or off center.
- Gills, white spore print, universal veil, bulbus base.
- Gills, white spore print, scaly cap, grows on wood.
The common split gill or Schizophyllum commune has how many mating types?
- Approximately 100
- 4
- Over 20000
- 2
What do Chanterelles grow on?
- The ground
- Rotting logs
- Wood mulch
- Live trees
In the moss on the ground you notice a slim, soft black mushroom with a stem and an elongated oval head with a groove down the middle—a member of the genus Geoglossum, what most of us call:
- Earth Tongue
- Ribbed Cup
- Black Foot Morel
- Hare’s Ear
Using a magnifying glass, you investigate some tiny, red, cup-shaped fungi on a dead log, and find that each one is lined with dark “hairs”. They belong to the genus Scutellinia and are known as
- Hairy Fairy Cups
- Scarlet Cups
- Eyelash Cups
- Jelly Cups
Grifola frondosa is a polypore mushroom typically found at the base of oak trees in the fall and is a choice edible. It's common name is:
- Sheep's head
- All of these
- Hen of the woods
- Signorina mushroom
- Maitake
You come across Galiella rufa--thick, peanut-butter-brown, cup-shaped mushrooms attached to a stick on the ground. Each is surrounded by a dry, finely hairy, black outer surface, which squishes like a soft gum drop. They are commonly called:
- Peanut Butter Cups
- Goodyear Fungus
- Black Jelly
- Hairy Rubber Cups
These mushrooms are not social distancing. How would you describe them?
- Single
- Scattered
- Caespitose
- Nongregarious
What is this very common mushroom?
- False turkey tail (Stereum ostrea)
- Turkey tail (Trametes versicolor)
- Violet Toothed polypore (Trichaptum biforme)
- Crowded Parchment (Stereum complicatum)
What color are the spores of oyster mushrooms?
- Purple
- Rusty brown
- Green
- White to yellow to lyliac
Urnula craterium would be a perfect Halloween fungus, but alas! This dark and creepy cauldron only grows in early spring. Its common name is:
- Devil’s Urn
- Earth Tongue
- Hairy Fairy Cup
- Dead Man’s Fingers
How many spores does a giant puffball (Calvatia gigantea) contain?
- Over a trillion
- Ten thousand
- 1 million
- 1 billion
Advanced question. In most guide books only one or two eyelash cup species are listed. So far we have identified 6 diffenret species using their microscopic features. Using the images of the spores and other identifying features and measurement values can you identify this species? Average 18 µm by 11 µm Q=1.65 with large warts that mostly have interconnections. Black/Brown margin hairs are ~1650 µm long, rooting with 2 to 3 forks and a pointed top. Hair width ~42µm close to base, hair wall thickness ~7µm.
Use this key to identify the exact species of we have found.
- Scutellinia crinita
- Scutellinia setosa
- Scutellinia pennsylvanica
- Scutellinia scutellate
Which one of these is this a Chanterelle mushroom?
Advanced question. This is a DNA sequence or barcode for an ITS region of a fungi. What species is it from?
>WPMC20131005-2-4
ACTTTTTGTAGGCTTGGTGGGATAGGCTGACTTCGGTCGGCTTTGAATGCCTCGCCTATGTATTAAAACAAACGCTTCAG TTTAGAATGTAACCTTGCATAATAAGCAAATAAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAA CGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGG TATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGTATCATCAACCTTCAACACTTTTGTGTCTGTAGGCTTGGACTTGGA GGTCGTGTCGGCGTTCGCGTCGGCTCCTCTGAAATGCATTAGCGTGAATCTTACGAATCGCCCTCGGTGTGATAATTTCT ACGCCGTAGACGTGCAGTATATAGTGTTCGTGCTTACAACCGTCTGCRAAGACAACATCATTGACAATCTGACCTCAAAT CAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCG AGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTCGATCGTCCGAGTTGTAGTCTGGAGAAGCGTCTTCCGCG CTGGACCGTGTACAAGTCTCTTGGAAYAGAGCGTCGTAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTT GTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTG GCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAAT TGCTGAAAGGGAAACGATTGAAGTCAGTCGCGTCGTCTAGAACTCAACCTTGCCTCGGCTCGGTGCATTTTCTAGTTGAC GGGCCAGCATCAGTTTTGACCGTTGGAAAAAGGTCCTTGGAATGTGGCACCTTCGGGTGTGTTATAGCCTCGGGTCGTAT ACGACGGTTGGGACTGAGGACCGCAGCACGCCTTTATGGCCGGGG
You will need to use the online BLAST server to identify it. Tip: Search the entire nucleotide database rather than the ITS type sequence subset to obtain a good result.
Sarcoscypha austriaca, one of the first colorful cup fungi to peek out from under the dead leaves in spring, is commonly known as:
- Elfin Saddle
- False Morel
- Scarlet Cup
- Eyelash Cup
Are those creepy fingers sticking out of the ground? Grayish blue-green with lighter “nails” in May and June; later in the year they will turn black and a bit bumpy. They are Xylaria polymorpha, commonly known as:
- Devil’s Urn
- Black Crust
- Dead Man’s Fingers
- Brittle Cinder
What is a slime mold?
- A lichen
- Single celled organism that fuse together to form a fruiting body.
- A type of fungi
- A multicellular organism
Intermediate question. Which mushroom toxin causes an adverse reaction to alcohol similar to Disulfiram (Anatbuse) used to treat chronic alcoholism?
- α-Amanitin
- Coprine
- Muscarine
- Gyromitrin
On a damp log, you find a decorative grouping of soft gray, merging circles and ovals, each surrounded by clean white as they spread along the surface of the log. Its official name (quite a tongue twister) is Kretzschmaria deusta. The soft colors will soon become black and flaky, which has earned it the name:
- Black Crust
- Black Flakes
- Brittle Cinder
- Spreading Crust
Which of the following is false regarding the aborted entoloma?
- Irregular white blobs with a marbled pinkish brown interior
- Caused by Entoloma abortivum parasitizing Armillaria species
- It is edible
- Turns bright blue when cut
Email
This field is for validation purposes and should be left unchanged.

Mushroom Quiz

Mushroom quiz

Events

Recent Comments

Mushroom Catalog