Mushroom Quiz

Here is a little test of your mushroom knowledge that club identifiers Fluff Berger, John Stuart and Richard Jacob have prepared. The questions range from easy to quite hard and you may have to do a bit of research. We hope it gives you a little something to think about while in lock down. Let us know if you like it. Also if you have questions to add to the quiz please email. The questions cover the sort of capabilities that the quiz software can support.

Mushroom quiz

  • Use this key to identify the exact species of we have found.

  • >WPMC20131005-2-4
    ACTTTTTGTAGGCTTGGTGGGATAGGCTGACTTCGGTCGGCTTTGAATGCCTCGCCTATGTATTAAAACAAACGCTTCAG TTTAGAATGTAACCTTGCATAATAAGCAAATAAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAA CGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGG TATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGTATCATCAACCTTCAACACTTTTGTGTCTGTAGGCTTGGACTTGGA GGTCGTGTCGGCGTTCGCGTCGGCTCCTCTGAAATGCATTAGCGTGAATCTTACGAATCGCCCTCGGTGTGATAATTTCT ACGCCGTAGACGTGCAGTATATAGTGTTCGTGCTTACAACCGTCTGCRAAGACAACATCATTGACAATCTGACCTCAAAT CAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCG AGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTCGATCGTCCGAGTTGTAGTCTGGAGAAGCGTCTTCCGCG CTGGACCGTGTACAAGTCTCTTGGAAYAGAGCGTCGTAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTT GTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTG GCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAAT TGCTGAAAGGGAAACGATTGAAGTCAGTCGCGTCGTCTAGAACTCAACCTTGCCTCGGCTCGGTGCATTTTCTAGTTGAC GGGCCAGCATCAGTTTTGACCGTTGGAAAAAGGTCCTTGGAATGTGGCACCTTCGGGTGTGTTATAGCCTCGGGTCGTAT ACGACGGTTGGGACTGAGGACCGCAGCACGCCTTTATGGCCGGGG
    You will need to use the online BLAST server to identify it. Tip: Search the entire nucleotide database rather than the ITS type sequence subset to obtain a good result.
  • This field is for validation purposes and should be left unchanged.